Never-never Land, Abu & Mr Bukhari

Over the last 2 or 3 weeks, we’ve been set group tasks. Firstly we had to decide on a name a place and an object, then basically we were asked to flesh out the situation we had created with back stories and further information.

From the notes we (Bryn & Johnny) made in the initial session, I came up with this as a concept:

Mr Bukhari is thinking:

They never understand. They never understand. I am never understood. I understand them though. Why do they never….. I should have some tea. Its the right thing to do. Tea and a cigarette, then I’ll be able to think clearly. They NEVER understand, the simplest thing! If the light goes out you fix it. No sauce means no sauce- I understand! Why… they never! Bloody Tuesday. Tuesdays, if I write a sign, why do they never read it? Sign read. Read sign.

I think its a sign. Why would the almighty decree it, if it were not a sign. Never does a thing happy without a good cause. Never. I told her that and she never listens to a thing I say. “Never does your lip move without good grievance” is what she said. Never a useful thing. And they’re never easy, never move without a problem, never do they clean behind the sink at 22 or the downstairs utility on the avenue. They never get 200 quid though. Huh.

I never think clearly these days. I used to never be angry, I’m sure, never now though. Well, I never. Those happy slapper, little posh girl with bloody miniskirt. They underestimate me, they never get money back and got once in life-time, never-again chili kebab sauce. . . Huh.

Tea good though! I need my tea. Why people never know that I take 8, and black. Stupid bloody people. Understand…. never you do. Why I never have tea when its needed and it always last never long enough for me. I never going to explain myself again if they never understand me, never explain. Only to Mr Bukari, he is the only one that will understand my never land. Why is he never here any more? What size are my shoes?

Pan to shoes and then up to a fast-boiling whistling kettle that has been silent until then. Maybe it should be visible throughout, but the sound only becomes audible right at the end. The full story is this; Mr Bukhari has been talking over the noise of his kettle constantly boiling. He has slowly descended within himself and become mentally ill, taken over by his own anger, temper and contempt for his customers, his friends and his family. Shot from “within” Mr Bukhari’s head, so hold the camera to some one’s face looking out. Throughout we can cut in relevant clips to the things he is talking about.

We never actually filmed this and it didn’t go any further, but I’m still quite fond of the idea, despite its obvious use of ethnic stereotyping I think it could become an evocative short film.

The name Mr Bukhari was my initial contribution- it is the same name as my landlord. However, my own Mr Bukhari is an excellent landlord and doesn’t share any of the fictional one’s character.


Robin Hood’s Bay; It was my birthday on the 21st October, this is one of the two cards I got (both from my parents, albeit on separate occasions). I really love the image, one reason is that the place is familiar to me (Robin Hood’s Bay, North Yorkshire) and invokes many childhood memories and the other is the aesthetic qualities of the image itself. This is actually a photograph across the bay, amazing.

As a second part to the video project I wrote about above we had to do exactly the same thing as before but use somebody else’s words rather than coming up with them ourselves. We ended up with Abu Baker, Amsterdam and a pair of shoes. Having failed to complete the previous task me and Bryn were extremely keen to get this done (unfortunately we failed to hook up with Johnny and include him, I think this was down to his work commitments).

This is my initial idea for the concept, but again we didn’t use much of this in the final product.


Abu in Amsterdam

[the name is meant to be Abu Baker, not Abu Craig]

Fast opening sequence, showing some running [pan from the chaser’s feet to the person being chased] (chasing “the victim”), traffic, city scenes and finishing on the canal (which is the scene of the crime). Focus on a pair of shoes (maybe could get the same red shoes that Aliyah and Emily used).

Fade into the interview room.

Concept notes;

Abu Craig is a suspect in the killing of a prostitute and a mob boss in Amsterdam. The police have been tipped off anonymously that the man behind the incident was called Abu Craig, the mystery caller also said “He’ll know Cecila”. They have no further information in relation with the matter, no witnesses or anything else that be constituted as evidence. The police are basically run by the mob, and they’re after someone’s blood to avenge the death of the leader. They’ve tracked down all the people on their intelligence network of the name Abu Craig.

The real story is that a group of Russian gangsters are trying to muscle in on the crime revenue to be gained in Amsterdam, particularly interested in people trafficking and importing large quantities of cocaine and heroin. They think that by killing a particular Dutch mobster they can unsettle the community so much that they’ll be able to move in without too much of a fuss. They murder the boss and throw in a dead prostitute to add to the confusion. At the crime scene mysteriously there are a pair of red high-heeled shoes. These turn out to be the shoes that the Russian boss’s wife was wearing the night she slept with Abu1. His wife is called Cecila.

The middle of the film is comprised of interview footage of several people, all going by the name Abu Craig.

Abu1 is from Birmingham and turns out to be the man they’re after. He is being framed by the Russian mafia who are the real culprits. The only reason they picked him is because he once slept with one of the bosses mistresses many years ago and has no other connection to the incident. He did once meet Abu4 in Camden during the 80s. He will cooperate fully with the police.

Abu2’s girlfriend lives in Amsterdam and he lives outside the city. He’s always thought it would be cool to be a drug dealer but doesn’t have the connections. Apart from petty things he’s never committed any real crimes so has nothing to fear from the police.

Abu3 studied economics at Oxford and went to public school. He doesn’t have a shady side at all. He is however not accustomed to being in police interview rooms and so is a bit shaken by the whole thing. He doesn’t want his girlfriend to find out that he slept with a prostitute (who called herself Cecila) when he was in Amsterdam for a business trip. He used to enjoy wearing women’s clothes, and did have a pair of shoes similar to those at the murder scene.

Abu4 is a drug dealer from London (this is how he met Abu1, in his early days he pedalled 10 bags of weed in Camden). He was in Amsterdam trying to do some underworld networking to find someone to import dope directly from the Netherlands to London. So, understandably he is quite edgy about the fact the police have called him in (he doesn’t know it’s purely because of his name). Although he failed to make any business connections as he had intended, he did manage to pick up quite a bit of the underworld gossip. He has heard about the district the incident happened in, and knows it is where most of the mobs major deals go down. He knows the Russians are trying to shake up Amsterdam because they’ve been pushed out of a lot of eastern Europe since the fall of the USSR.

Abu5 is nothing to do with anything. He is an part of the Saudi royal family (so therefore incredibly rich) and is disgusted he was arrested on landing at the airport. He came to Amsterdam for kinky sexy and sexy drugs, and he’s not ashamed about shouting it out loud to the police just so long as they let him go. He wants his Ambassador. He has a fake passport with the name “Clarance Richardson”.

Interviewer: Confirm your full name please.

Abu1: Abu Craig [repeat for each Abu we interview]

Interviewer: Were you in Amsterdam on Tuesday of last week?

The idea is that the responses aren’t scripting (as they’re written here) but we will record the response to all of the questions here after actors have been given their background information.

Abu1: I went through Schipol on my way to Birmingham. I have my tickets still in my brief case.

Abu2: Yeah.

Abu3: Yes.

Abu4: I’m not answering any questions without my lawyer present.

Abu5: This is an outrage. I came to see vice and colours. Let me out of this shit hole now! I want to see my Ambassador. There will be repercussions if you do not co-operate.

Interviewer: Excuse me sir but I must insist things are quite different to that- if I were in your position I think you should be cooperating with me!

You are familiar with the Vondelstraat area?

What was your business in Amsterdam?

Do you know a woman called Cecila?

Have you ever met a man called [dead guys name]?

Do you know who he is?

Do you take drugs?

Have you ever used a prostitute?

Have you ever met [prostitute’s name]?

Would it shock you if I said she was dead?

Did you drink or take any drugs that night?

What were you wearing last Tuesday?

Are you the real Abu Craig? What other names do you use?

What is your business? How do you make your money?

Would you like me to call a lawyer for you?

etc etc

[continue contrasting different reactions to the same question until the truth is clear, or a version of it. Whodunit style.....]

These are some of the notes from a brain storming session me and Bryn did before filming. Click on them for larger images.



The film we finally made was about a British Tourist who was named Abu Baker. He is on a visit to Amsterdam, claiming that it is a “pleasure” visit, his motives are never clear. Although its not immediately obvious, the film tries to convey a sense of Abu’s obvious guilt. I play the police interview and Bryn is playing Abu.

I was really pleased with the end result. Bryn plays the guilty man really well, especially as the whole thing is entirely improvised. Mixing the video footage we took (in student halls) with shots of Bryn walking around the darker parts of Manchester city centre, the film achieves a prolonged sense of dread and uneasiness. All of the non-interview shots are sequential still photographs that have been animated. The whole sound track of the film is encompassed with a huge reverb sound, so the relatively few words you hear sound distant and haunting. In addition the entire video has been processed to have a dramatic aura, the makes the dark parts and as black as they can be and the bright parts are unnaturally vivid.

This is the first non-music video that I have filmed or edited (let alone both), but I’m extremely pleased with the end result. Having said that, I was happier with a previous cut (that was nearly two minutes shorter), but unfortunately due to a brain-malfunction I deleted that version. I feel that where the film really comes into its own is where the animated sections are cut in (and the timing of when they’re cut in) and with the extremely fast digital zooming and panning onto Abu’s nervous twitching and guilty eyes. I’d really like to make another film, maybe (definitely) less black, but using the same techniques. I’m also really pleased with managing to fuse “proper” video and animated photographs. Most of my films use photographs as their basis but having the possibility of using video and photos is the next area to explore is something to relish.

You can view the end result (at degraded quality, unfortunately) on YouTube here; http://www.youtube.com/watch?v=B7O7xRmJz6A

This is a shot of Bryn (playing Abu) walking along a canal near Deansgate locks in Manchester. We chose the canal because of the obvious parallel to Amsterdam. Fortunately there were some CCTV cameras there which fitted nicely into the eventual plot. Also I feel the lighting and colours contribute well to the general feeling we were trying to achieve. This is one of the still photographs that were animated and cut into the video at appropriate moments.

As a result of posting the film to YouTube I’ve been approached by a television broadcaster based in the United States, requesting a copy to include in one of their programmes. This has come as an unexpected, but welcome bonus!

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline