Clean Sheets

Its a bit odd, for someone with a bed as unpleasant and messy as my own, but I really lust after the feeling of newsly laundered sheets that are freshly put on a bed.

Maybe I should have them more!

An ex-colleague of mine, Matthew McArdle, said he irons his sheets so they’re perfectly smooth.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline