Adele Prince & Mars Bars

Adele Prince (an Interactive Arts graduate) came to talk to my group this week. She has been very successful with exhibitions, commissions and winning an innovation prize from the Yahoo! website. Through her various projects she has also attracted a lot of media coverage. Her success alone was enough to keep me attentive, but as it turned out I really enjoyed the presentation and her work definately aroused my interest. Most of Adele’s projects seemed to utilise the web, with more recent work reflecting the changes in the how the internet is used and having a distinctly Web 2.0 feel about them. One of her latest works, involved being tracked via GPS, which updated her position on a map on a website, and being given instruction via mobile phone – very technology heavy! This web-centricity was particularly interesting to me; as many of my ideas and things I’d like to do involve the same kind of things.

One commission that Adele showed us, was for a train station in Linconshire. How she created her work (which was a video installation) was to travel the length of the trainline and alongside it. But she did this by foot, taking photographs at 5 minute intervals throughout (the whole journey took several days). With the journey complete the photographs were Adele’s source material, along with video footage recorded by her boyfriend who was following her on a bicycle. The end result is displayed on two video monitors housed within the station ticket office. I really liked this concept, its the kind of self-involving art that I really like. I guess there is something of a likeness to post modernism with exposed self-referencing, that really gets my juices flowing. With this piece I like it that there is no certainty about what the images would be, but together they can be directly relevant to the subject.

Another piece of work she talked about (my favourite I think) was her “Lost Something?” website. This was born from Adele collecting lost items from the street, and cataloging the item, where it was found, and when. Eventually all these items were compiled and uploaded onto a website. People can log on to the website, check the list and see if their lost item is there. Launched in the late 90s Adele still recieves many emails per week with regard to the lost items on the website.

Adele seems to have been prolific since leaving University, with further projects including Lost Something and another web-based affair; Trolley Spotting. Trolley Spotting is an online database (with maps & images) chronicling Adele’s journeys around various cities to find trolleys. It is true that trolleys turn up in many odd places!

I’m enticed by the all Adele’s work, and it is very reminicent of a number of my own concepts – I couldn’t help but feel there was something missing for most of the projects. Like a “missing link”. Of course this is just my preference, and I was exceedingly excited to see someone doing things so similar to some of my aspirations. Also her success speaks for itself.

The presentation did make me think back to discovering the Bookcrossing.com website. On the site, you register your details and you’re then given a serial number. You print the number in a book, which you then leave anywhere you like! The idea is that someone else finds the book, which as well as the serial number has details of how to get the website. They then register the fact that they’ve found the book, where, when, how etc then once they’re finished with the book they are supposed to leave it somewhere else. Thus you get a large network of people sharing books with people using the Internet as a medium for tracking it.

There is another website called WheresGeorge.com and another called PhotoTag.org – one tracks US currency and the other disposable cameras (and then shows the pictures taken with each camera). The ideaology seems very similar to that of a lot of mail artists, but in this case making the most out of the internet.

When I discovered these websites (about 3 years ago now) the concept of each struck a chord with me; and I started trying to wrack my brains to figure out something similar that I could set up myself. The lost something idea was one that came to mind (I was unaware Adele had done it!), but I decided it would only really work as a self-contained thing if the lost objects were posted on the website by its users, rather than just me, and that this would constitute a massive programming task!

The thing that really turned me on about BookCrossing (which, incidentally, is now a word in the Oxford English dictionary!) was the fact that the people interacting with the site were giving each other a gift. Even if it is to a complete stranger! I like this idea of not being able to control something, but engineering conditions so the “art” actually evolves by itself (plus its always nice to get something for free, from another person). The concept is quite similar to Dave Gorman’s book Googlewhack Adventure, which is an amazing book. I think it qualifies to be called a work of art.

Mars Bars! I think the reason I chose Mars bars was that it rhymes, and I liked the phrase “Mars bars go far..”

My plan is to create a replica of the BookCrossing system, but modified so that Mars bars are the subject, rather than books. I will start with, say, 100 Mars which I will release through a variety of methods – each of them tagged with their own serial number and instructions. Whoever finds or recieves one of the bars, is instructed to log on to the website and record the fact they’ve recieved (and eaten!) the chocolate they are then requested to purchase a replacement chocolate add a serial number (provided by the website) and release that bar.

I would love to create this chocolate giving network, see how far it can spread, track its progress, ultimately see where it takes me and see where it takes the Mars bars.

Later on, I had two thoughts; firstly I was worried about the legality of using the Mars company’s trademarks but then that led me to thinking how valuable it maybe for the company. I wonder if I could create such a thing and sell it to Mars as a viral marketing technique or simply tell Mars about the project and see if they would give me a nominal sponsor to get it off the ground.

So I’m extremely grateful to Adele for rekindling my interest in this kind of project and very pleased to have been made aware of her work, which I’m going to be watching with a keen eye. Maybe at some point we could join forces! Its funny how things work together, I started doing my first computer programming in ages with Max/MSP last week, and now I’m thinking about doing a whole load more.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline