The End is Nigh

It feels to me as if something is coming close to an end. I can’t quite figure out what it is, is it the impending hand-in date for this journal? Or is it the now ever-constant coverage of global warming that’s getting me down? Or could it be the ever-dwindling student loan in my bank account combined with a scarily low number of days before the end of my University year. It all seems to have just sneaked into my consciousness without much prior warning.


Ending. Owned by my friend Fred it is memories of this guitar that are my first memories of any guitar. It seems to have been around for ever and I’m sure has inspired many; well at least me and Fred. This is a ritual burning of it, after it was rendered useless by a short drunken Scottish man.

I’m currently on a skiing trip in Vallandry, a small alpine village near Albertville in southern France. I’ve been here a few times before, but not for 3 or 4 years. Nothing has changed though, except here there is, too, a new-found awareness of global warming issues. The risk of the skiing trade disappearing has just jumped from nothing, to everything (in the property investors minds, anyway).

Climate change is a serious issue, but as it is patently clear; we’ve created a big problem. We now have to tackle the problem with gusto – I can’t think how better to put it! Believe it or not, when I phoned up my school friend Lindsay when I was 13, really distressed about the fact the world was “going to fuck up” imminently, I reflected (at the time) that I was overreacting. I guess I wasn’t really.
Unforgiving Mountain.

I just read in a newspaper that British Airways looses 23 bags out of each 1000 they load on to a plane – the worst in Europe.

Compliance. After jumping through hoops, doing obstacle courses, burning enough fuel to power the city for a day and a financial outlay equal to a small country’s national debt; I finally received my valid UK passport. It was ordained with this insightful label.

I’m on holiday with my immediate family – a Christmas present to to us all from my Dad – and also with my auntie, uncle and two of their friends. Its quite a giggle and definitely a stark contrast to my cleshay-ridden and wholly student-like existence. Without going into too much detail describing my friends and family’s background; being on holiday with such a concentration of knowledge and intellect, that is rooted in such different methods and concepts to that of my peer group, is very uplifting. Inspirational in a way.

Last night a conversation arose about sudoku, it turns out my auntie is an avid player, while my uncle doesn’t really play at all. I’m quite a fan of sudoku, despite the huge amount of time it takes me to complete even an easy grid. Its a real art form. Apparently, this is the number of combinations you could have for a 9*9 sudoku grid.

Six sextillion, six hundred and seventy quintillion,
nine hundred and three quadrillion,
seven hundred and fifty two trillion,
twenty one billion, seventy two million,
nine hundred and thirty six thousand,
nine hundred and sixty.

Its definitely one of those things where the actual number doesn’t matter. You just know; its a lot.

I also read an amazing article in the New Scientist last night (New Scientist makes excellent holiday reading, although I forgot this week and had to borrow my brother’s copy!) that talked about number patterns just like sudoku. Mathematicians in the Europe only discovered these magic ways of arranging number in the last few hundred years, even though the Chinese have been aware of them for over 4000 years. Fancy that. It turns out that these magic squares, which are the same as sudoku squares, are actually invaluable tools for writing computer error-checking codes. By utilising these squares, a computer or electronic circuit, can transmit a message over an extremely “noisy” wire and actually decode it at the other end. By using the square, a computer can convert an extremely poorly transmitted message with missing or incorrect characters in, such as; ” e i br n rox he zlay uog” into the correct message “the quick brown fox jumps over the lazy dog”.

The same kind of techniques are used already for the Internet, digital TV and CD/DVD drives, but by utilising the sudoku squares scientists can transmit high-bandwidth digital signals over electric power lines – the hardest thing to send a message through because of the extreme high voltage and crudeness of the lines. Its quite an odd thing to write about in the context of art, but for one it gave me that warm feeling I get when I see a movie that I really love, or an inspirational piece of art work, or listen to an amazing piece of music. But secondly, the point that really grabbed me was that mathematicians discovered these number patterns some time ago, but never really understood them and just thought of them as a game. Now they’re being used at the cutting edge of technology to do something truly influential. The article included the sentence “maths can, once again, be seen as an art form.” I think that’s kinda cool.

Origami by Joe Gilardi. This is a dollar bill, creased, folder, cut up and put together again in this form. Another musing I arrived at whilst reading the New Scientist was the crossovers that exist between high-level mathematics, magical illusions and art; they’re rife. I doubt I could be a magician, but it’d be cool to explore any artistic magical possibilities that arise.

During our conversation about Sudoku, however, my uncle (a psychiatrist, psychotherapist and author) raised a question of what it is to guess? Also how to distinguish between this and an estimate. I wish my alcohol-impaired brain could remember the exact context of the question; it was to do with the human way (as opposed to a computer) of completing a sudoku grid- almost everyone makes assumptions that they’re not sure of in order to see if they’re correct. Just like guessing a word in a crossword; you may be wrong but even if it is it may well lead to some other correct answers. I thought it’d be cool to do some work reflecting on humans ability to guess and estimate. I’m sure that most guesses are actually more informed than the “guessee” thinks at the time.


Irrelevant Pomp. I created a WikiPedia page for my Dad… it says it “Lacks Relevance”. In fitting with that sentiment, here is a photo that lacks relevance, but one that I think captures the spirit of an instant in London.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline