Bringing anarchy to a Wiki

A Wiki, is a website that allows its users to add, edit, delete or change its own content. WikiPedia (http://www.wikipedia.org/) is a free encyclopedia that functions in just this manner.

My friend Matthew spent some time earlier this year deliberately trying to sabotage WikiPedia. I think it came about out of boredom, and mainly focused on changing entries subtly so they included a reference to goats. For instance doctoring the page about US president George Bush so the first sentance read; George Walker Bush (born July 6, 1946) is the 43rd and current U.S. President, serving from January 20, 2001 and he is not a goat.

All of Matthew’s edits were reversed, usually within minutes, sometimes seconds and occasionally taking a little longer. So the system works. Matt (and my) IP address (the thing that uniquely identifies computers on the internet) was relatively quickly banned from making edits for a week. Apparently there are actually many people that spend incongruous amounts of time editing WikiPedia, and indeed have become addicted to it. Bizarre.

Initially I thought maybe doing the same as Matthew could constitute as a work of art somehow, but then remembered that WikiPedia is invaluable to me as a research tool and is one of the few resources that out-and-out trust what it says. This comes down to the ethos of WikiPedia editors and its rules and regulations, two of which are;

  • Neutral Point of View: All Wikipedia articles and other encyclopedic content must be written from a neutral point of view (NPOV), representing fairly and without bias all significant views that have been published by reliable sources.
  • Attribution: Wikipedia is an encyclopedia, not a publisher of original thought. The threshold for inclusion in Wikipedia is whether material is attributable to a reliable published source, not whether it is true. Wikipedia is not the place to publish your opinions, experiences, or arguments.

Much as these rules create a brilliant resource, they (purposefully) prevent people from using WikiPedia as a forum for original thought or self-promotion and it is enforced strictly. Again, I agree with this whole heatedly, but can’t help but think its not fair that all the successful artists, musicians and writers are on WikiPedia and may derive promotional value from that. Whereas anyone unknown or aspirational can’t get onto the resource, because nobody knows who they are and nothing is published elsewhere about them. Catch 22.

I created a WikiPedia page about my Dad, to see if his credentials were enough to allow his page to be left on and not deleted. So far this has worked http://en.wikipedia.org/wiki/Richard_lindley has been live on WikiPedia for a few weeks now, despite containing a warning that “this article lacks information on the notability (importance) of the subject matter”. So not perfect. I could probably put something on the page that would give it some kind of importance, though I’m not entirely sure what. I should put he is father to aspirational artist Joseph, which would maybe get my foot in the door.

I came across a kind of paradox that will, potentially, allow me to achieve my desire of having my own WikiPedia entry. I guess the reason I want this is that is feels like a sign that I would have arrived as an artist, if the WikiPedia editors think that I have the required notability. How it would work, is that I systematically sabotage WikiPedia, but work to a rationale. Realistically I think it would have to involve an aspect of networking too, for instance getting multiple other people to help me as the task is too big for one. Otherwise I could write a computer program to do it. If I can get around the constant re-editing by the WikiPedia monitors, and alter something sufficiently thought-provoking or controversial, enough times and involve enough people; ultimately I could evoke so much interest that I could then get media coverage (even if it is local) or better some sort of comment from a critic. This in turn should constitute relevance and notability enough that my page on WikiPedia would be allowed.

It may seem a bit ridiculous, with that long explanation, but I really think it would work and if its done in the right way it could actually have artistic merit.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline