Art Spam, Spam Art, spArt I suppose

What is Spam Art?

I have a new harebrained “artistic” scheme. As the title suggests it is to do with spam.

I read about something I thought that was cool; a guy had simply created a dedicated email inbox and ensured that it received lots of spam all the time (not too difficult these days). Then a computer printed all of the messages that were delivered into that inbox and immediately the paper it was printed on was shredded.

I liked it – but a little one dimensional I suppose (I probably wouldn’t have said that if I’d have thought of it first and done it, however).

Another interactive art work I read about, that utilised the Internet, was the guy that had a balloon rigged to an air-pump that was triggered by hits on his blog. Anyone who looked at his blog could rest-assured that their hit, inflated the balloon that little bit more – at the end of one day the balloon was popped.

I really loved this concept. I’m not sure quite what it was meant to represent, but it definitely appealed to my tastes.

Try googling “spam art” – loads of cool results.

My Ideas & Testing the Concept

What I would like to do started with the idea of running two pieces of software on a gallery-based computer. The first program continuously spiders the web and builds an ever-growing database of email addresses. Despite the spam it attracts there are still millions and millions of such addresses out there on the web. The second program would send a message to each of the emails that the spider discovers.

Responses to the sent message would also be displayed by the computer and be published on a blog.

I guess I’m interested in turning the tables on spam, so for somebody out there they will receive my spam and be surprised and joyed at the fact that it isn’t actually the traditional form of spam. If they respond they will be interacting with anyone who looks at the gallery-situated computer or the blog. Thus my interactive art is born.

I tested the concept with a few hundred email addresses that I collected using a simple spidering program, and this has generated a few replies – mostly encouraging. One or two slightly angry or annoyed…. not surprisingly (I am sorry..!)

Take a look at the email I sent here.

The responses have ranged from;

Hi, what exactly is the purpose of this project? And what is the “art” for this project?

To lovely and encouraging responses like this from Anne-Marie;

I am always very happy to see that Students “in general” still have
ideas ! (you are the future my Dear…and the world depends on you all)
:-)

And this is the major point that I have to address:

How is art different from spam?David K

Many thanks to everyone who did respond – you’ve helped me a lot.

Also another huge debt to the open source developers who wrote PHPList and all of its components.

Where’s it going?

Well there is quite a development overhead with a project like this; for it to work seamlessly. For my initial test I’ve been filling in all the gaps that ultimately a computer will have to, but I reckon it has proved the concept well.

I’ve refined the idea through the testing. The part of the project that I really want to nurture is the relationship between the email content and the people that receive it. That was one of the most interesting concerns of the people that responded; the content must be relevant or of interest somehow – otherwise the email still constitutes itself as spam and will not be enjoyed by its recipients! So where do I find the content for emails so it will be relevant?

My current thinking is that all the emails that are sent to members of my spam list will actually be generated by users through a website. The website will serve as a medium for any single person to communicate a nuance of thought to (potentially) many thousands of “subscribers”. It can also be a hub for responses generated by any of these “spammed thoughts” to be displayed on the web. I’ve also concluded that anyone who receives these emails must not in an unsolicited manner. It just doesn’t quite sit right with most people (or myself).

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

3 Comments »

  1. Dear Joe,

    While this is a friendly piece of spam (which made it through the office filters), I do occasionally see such things anyway – urban myths, jokes or chain emails without the annoying threat elements.

    Useful spam is an interesting idea, one I suspect will remain a very vague hypothesis.

    While mass invititations to email a single address is turning the tables on spam in a technical way, it doesn’t turn the tables on actual spammers (which I’d like to see but understand that the technical difficulties are probably too great).

    You seem to be creating ‘reverse spam’ rather than ‘anti-spam’.

    I hope no-one get themselves fired for inviting a deluge onto their office servers.

    All the best with your spart project.

  2. Sheila Queen of Scots says:

    Phonological Awareness – this might add to the Phun! go for it.. hope your experiment goes in every unantipipated direction possible! Art from spam making SPART- can’t hurt!

    Sequencing
    Rhyming Words
    Compound Words
    Alliteration
    Words in Sentence
    Rhyming Nonsense
    Phonemic Awareness

    http://www.twinfield.net/teachers/fowler/classroom/resources/poetry_project/index2.htm#pdtop

  3. Judy Ross says:

    Hey I’m a sucker for anything that that has “art” in the address or subject line. Even though my art is more traditional in its medium I love to see creativity wherever.
    I just never dreamed I’d see it in spam oh excuse me I mean
    spart. Hey does this mean my website is now part of spart…cool.

RSS feed for comments on this post. / TrackBack URI

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline