Urban Myths at URBIS

I took part in ‘Urban Myths Retold’ at the Urbis museum, in Manchester. The project was off the back of a literature competition that Urbis had already run, asking writers to create short stories either re-telling or creating brand new urban legends. 10 performance-based installations took place at different sites around Urbis, that visitors viewed as part of a 1-hour-long guided tour.

The work that I took part in was based on the story “Three feet from Leroy” – about a man who becomes obsessed with what appears to be an imaginary rat; his fear lead by the legend that, in a City, you are never more than three feet away from a rat. My friend Bryn Lloyd-Evans had created a sculpture, reflecting on some of the themes running through the story.

To augment the physical sculpture, we created a word-based (using the prose) sound scape, that I performed using Ableton Live. In addition my girlfriend, Caiti Berry, “VJ’d” a video performance (using OpenTZT; cool software)that was projected over the sculpture and in a stair-well of the space we were in. The space itself was a claustrophobic service stairway, in the guts of the building; perfect for this performance but it turned out to be rather unpleasant to spend several hours in.

This is a photo-merged picture of our setup (click for a larger version);

Three feet from Leroy, performance setup at Urbis

A video of all of the installations is being produced, so hopefully I’ll be able to post that on here once it arrives.

Bryn is interested in doing some live performances of poetry, using similar techniques, so that is something to think about. Not sure if its right up my street or not.

This is the story;

Three feet from Leroy by Peter Canning

He knew that in the city you are never more that three feet away from a rat. he moved there anyway, but fatefully for him it would be the same rat. Its name was Leroy and it trailed him everywhere- his bedroom, the loo, his office, parks parachute jumps, lifts, buses and even romantic dinners.

Leroy, despite being a magnificent rat with dark fur and bright eyes, didn’t impress neighbours, colleagues or girlfriends. Soon the office was a distant memory and the only dinners he ate were for one. He grew to hate the vermin and laid poison, but Leroy was too clever.

The years passed. Leroy continued to stalk him down the bust streets and lonely alleyways, screeching mockingly at him whenever they were alone. Eventually, his rat-inspired loneliness drove him away from the city. As he left for his home town he saw in his mirror Leroy loitering irritably at the city limits and thanked his lucky starts that he’d soon have a life again.

But he began to miss those quiet nights when, like soldiers at Christmas 1916, he and Leroy agreed a truce of sorts, watching TV together and sharing a burger.

But his pride was too great for him to return to the city, to be reunited with his rodent friend. Until one day the local council won their fight to reclassify the town as a city. And as if by magic, he heard a screeching from under the floorboards.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline