Virgin Media; Overcharging and Sending the Bailiffs

When I moved house in August, I needed to get a broadband connection in. For a while I managed to use my neighbour’s unencrypted wireless, but I concluded I really needed to get my own connection.

I would have got Be Unlimited; which is very fast, and a very good deal. Unfortunately, BT said there was no line installed (even though I can see one….) and it would cost me £150 to install a phone line. The only option to avoid this charge, was get cable internet, now available through “Virgin Media” (what used to be NTL, Blueyonder, Telewest and the rest of them).

At the time Virgin Media were running an offer, that would provide 2Mbit cable broadband, for £10/month (for the first year) – this is a really good deal. I was unsure, because of reports of how terrible Virgin Media’s customer service was, and also talk of them throttling users during peak hours. In the end I decided to bite the bullet and ordered!

I ordered online, and was expecting my “Welcome pack” within a few days. In the end it didn’t come, so I called them up. Something had gone wrong, said the lady on the phone, because of them transferring their computer systems. She sorted it out, and promised that I would have my welcome pack in a few days. Sure enough, it arrived. The only thing was there were two of them! The courier noted this too, and we decided that he should take one of the welcome packs away.

So I get to installing everything… it didn’t work. Each welcome pack contains a cable modem, each of these has its own unique ID number. Unfortunately I sent back the one with the right ID number, so until I spent about £30 on phone calls to Virgin it didn’t work. They did sort it out eventually. During all these phone calls, it was obvious that they had created two “back office” accounts in my name – for one of these my name was “Lintley” rather than the correct “Lindley” – I told them several times about this, and they assured me that they had fixed the problem of the two accounts, they were very sorry, and everything would be fine.

At this point; I have paid Virgin Media a £25 one-off debit card payment. They told me this would be deducted from my bills. I had also given them my bank account details to set up a direct debit payment, and got confirmation back from them about that.

On the 24th October (according to my bank statement) Virgin Media took £34.80 from my account. This is in addition to the original £25 one-off payment. So since ordering at the end of August, I have paid them £59.80. Remember this contract is meant to be £10/month!

The next thing I know; I receive two bills. Photos of the two bills I got (at the start of November) are below. Obviously Virgin Media had not fixed the dual-account problem; each bill has a different account number. And they say drastically different things.

virginmedia-bill-1-medium.jpg

According to this bill, Virgin Media owe me, £28.35. I don’t know how they arrived at this figure, but I think it is probably correct. I had had the service 3 months, so that should have cost me £30. If you subtract what Virgin Media say they owe me from what I’ve actually paid; it leaves you with £31.45 – very close to what it should be.

HOWEVER!

At the same time I received the above bill I got this one;

virginmedia-bill-2-medium.jpg

As you can see, it is a different account number, and they’re claiming that I owe them £15. Given that the monthly bill should be £10 – I had no idea why they were saying £15. I decided I would ignore this, and let Virgin sort it out themselves, as it is obviously their mistake.

That was the wrong thing to do, 10 days late I got this letter, with reference to the £15 in the second bill, saying that my services will be disconnected and the file passed to debt recovery agency. Immediately I telephoned Virgin’s customer service people to ensure that they did not do this. They said (again) that they had fixed the double-account problem, and cited the merger of computer systems as the cause. Ok, I thought, the bailiffs won’t be calling, my credit file will be untarnished and so on. Think again…..

disconnection-letter-medium.jpg

When I spoke to Virgin about this they assured me that they understood it was their problem, and that it was all sorted out. They said I would not have my details passed to the debt recovery people, and they acknowledged it was not my fault and I did not owe them any money.

Lo and behold a few days later I get this letter;

debt-recovery-medium.jpg

So, it seems, Virgin Media have not ‘called off the dogs’. There will be plenty of angry phone calls flying out of my phone on Monday!

All of these errors are very annoying, scary, and potentially will end up with lots of ‘black marks’ on my credit file. However the shambles doesn’t end there. During my telephone correspondence with Virgin Media last week; they claimed that the offer (£10/month) that I signed up for never existed. “I’m sorry sir, we never had any offers at that price, your service costs £18/month”. There is plenty of proof available on the internet that the offer did exist.

I’m at a loss, this feels like Virgin Media are willfully trying to steal my money.

A few phone calls later; for no apparent reason the agent I was speaking to decided that the offer did exist, and said she would apply an £8 discount to my account, for the next 6 months. At which point I will have to call up again, and ask for the discount again.

I’ve found out I’m not alone, there are hundreds, if not thousands of very dis-satisfied Virgin Media customers writing about their experiences all over the web.

I’m extremely angry about being overcharged, but that seems to be the lesser of the issues. Effectively Virgin Media have stolen my identity. They’ve created two accounts in my name, at my address, and they’re threatening to come into my house and take my possessions. This if pretty rich, considering at the moment; they owe me money!

I’m in a right old Branston pickle, and I’m very angry about it.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

2 Comments »

  1. Ali_ba_ba says:

    I have suffered almost exactly the same issues as yourself! I too signed up for thje 2mb line @ £10 for 12months in Sept 07. Initially I spent £19.45 in phone calls trying to activiate the modem (duplicate accounts).Virgin has failed to correct spelling of my surname. Nor have they returned the intial £25 “installation fee” (un-avoidable despite opting of the self installation) Furthermore EVERY single bill has been incorrect. I have spent an additional £24 phoning their utterly incompetent billing department, only to be told that my offer did not exist (they even challanged me asking if I had the agreed price in writing). In fact the similarities are so uncanny I’m going to scan my bills to compare them to yours.

  2. kris finch says:

    They have done exactly the same to me…….Virgin are worse than second hand car dealers they have lied to me , stolen money off me and not given me a service i have over paid for.

    WARNING……if you are thinking about taking on a virgin account….BE WARNED IF SOMETHING GOES WRONG THEY WILL MAKE YOUR LIFE HELL……..DO NOT HAVE ANY DEALINGS WITH THIS CORRUPT HELL CALLED VIRGIN….you have been warned

RSS feed for comments on this post. / TrackBack URI

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline