April Work Plan

I think I’ve managed to recover from my February Plan. I was feeling very down-trodden at that point. Things seem to be just about in-hand. I even managed to do a few things that weren’t on my list, I made a video “Ups & Downs” (or I might call it “The Ups & Downs of Life” – I’m not sure) and I’ve actually managed to do some good music. Track count for album is going up. Also I’ve been experimenting with HDR photography.

Chorlton waterpark in HDR

Chorlton Waterpark in HDR.

Looking back to Febuary’s plan, this has been the progress:

  • Prayer 2.0. I’ve fixed all the major technical problems with Prayer 2.0 and I’ve redeveloped the code so that it is almost “modular”. I’m planning on having various other websites (thenewspam.com, whatiswebtoopointzero.com) which will be part of the Prayer 2.0 system. They will look and feel like separate websites, but will all actually be doing the same thing. I’m playing around with the idea anyway.
  • Photobombing. I applied for funding to travel the UK, and take Photobombing on tour. I failed. On the plus side I think I’ve arrived at the technical solution for Photobombing, after extensive research into different possibilities. I think I can do everything that I need to using Wordpress (like this website), Gallery2 (gallery software….) and various other plugins for both systems; a Google Maps plugin for geotagging and WPG2 to integrate the two systems together. Hurrah!
  • Second Life Project. Clicks and Links’ Designer is working on a first prototype!
  • Feedback w/Zimmy. We did a few test runs of running the video feed into a computer, then digitally manipulating the image before projecting it. We were attempting to use a hand-based movement sensitive controller to allow the viewer to change the image just my moving their hands (in free space). The desired result would be lovely-looking fractal-like images. Unfortunately it didn’t quite work out, but I think the problem is simply a computer-power one. I need a faster laptop. Other than that it worked great. I’m going to suggest to Zimmy that he applies to have his work projected onto the side of Urbis as part of the Diesel Wall 2008 (crappy advertising, but cool at the same time).
  • Phase Loops. I didn’t take this very far, but I got quite a good effect simply looping several 2 seconds samples of Branka saying “This is my mind” and having them slowly work their way out of phase. I played this to my year group, but lost confidence and skipped out about 2 minutes… silly.
  • MMU Wiki. The Wiki, is no longer a Wiki. But it is up and running! I’ve decided to run a Joomla system, rather than a Wiki. I spent several weeks researching different user-based systems, starting out with Wikis, but ending on more traditional CMS.

So I think all that is just about going okay, though there is still a long way to go. I’d really like to have my collaborations with Branka and Zimmy go further, but I also don’t want to “gatecrash” their projects, as well as being slightly preoccupied with my own things. The MMU site is probably the most daunting and difficult to pull off, and it also has little value to my practise, so I’m going to try and not get too worried about that. Second Life seems to be taking care of itself and as far as my web projects go I just have just do it. Thanks Nike, you corporate horribles.

So my current plans are;

  • Journal. This is my journal, my journal is this! Deadline is 21st April, so I have to make sure its finished off and contains everything it should. In reality I don’t think it will, but still, I can but try. Last year I was marked down because Gary thought that I didn’t have any lecture notes in my Journal. They were there! The problem was that they were actually photographs of my physical lecture notes, and he couldn’t read them. Doh! This year I’ve hardly been to any lectures, so at least that won’t be a problem!
  • Uni Video. We’ve been told to do a 5 minute video, to aid our end-of-year presentations. That is due one week after the Journal, so I must crack on with that. I have a good idea of how I’m going to make it, so once again its just a matter of doing it.
  • Music. Continue my music exploits, as ever. I got news that my record label has just recieved a 20,000 Swiss Franc grant for business development, which can’t be bad!
  • HDR. I’m having loads of fun, and getting good results with HDR, so I’m going to continue that.
  • Lines. My “Ups & Downs” video I think is a good concept, and I want to explore that further. Although both this and HDR imagery are completely outside of my “user-generated” remit, I think fingers in pies and all that.
  • Photobombing. The time is nigh. Almost…. get it all ready then go!
  • Film Concepts. I have at least three good ideas that I want to make a start at filming. They can all be on-going things.
  • Geocaching. Although my Blogcrossings seem to have gone dead, I’ve launched some more using Geocaching (and travel bugs) as a way to make it work. I’m having great fun with it, let the caching continue. I currently have about 15 tupperware boxes around the house, all set and ready to go. Manchester is going to be cache crazy.

Waterpark Trees

Waterpark Trees (again in HDR)
As well as these individual areas of work I’ve come to realise that I need to make my work a little more cohesive. I’m going to develop my mission statement, maybe even individual mission statements for individual projects. Simply put, I need to be able to say where I’m at with each thing, if asked.

Share:
  • Digg
  • del.icio.us
  • Facebook
  • LinkedIn
  • MySpace
  • StumbleUpon
  • Twitter

Leave a Reply

Digg
  • Kind of abandoned this Twitter account, follow joegalen instead! Got my first ever single out.. check it out! http://bit.ly/2MS945 #
Share:

Twitter Updates for 2009-10-11

Digg

So the degree show finally closed its doors today: leaving me one extremely tired, yet elated, human being. The response to my piece was fantastic, and it was down to everyone who contributed their thoughts and doodles that it went so well. I took around 13,000 photographs over the last week, which were all included in the piece at some point or another – they’ll be posted here very soon. I’m going to exhibit the same piece at the Printworks in Manchester during July, so if you missed the degree show, come along. More info on that soon.

So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Share:

MMU Degree Show

Digg
  • I’d love you to vote for me here….. http://is.gd/GGcm – and otherwise looks like a good event all round. #
Share:

Twitter Updates for 2009-05-31

Digg

I’ve entered this interesting competition; it’s asking for concepts for 12 flash mobbing events, to be held in Manchester in July.  My idea is for all of the attendants to take photographs simultaneously on their mobile phones, and then blutooth them to a central hub to be displayed on a big screen. Vote for me here.

Share:

Cutting Room Experiment; My Entry

Digg

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Share:

Baker’s Yeast Sonification

Stuck in the middle

I won! I found out quite a while ago actually. My pitch for the HDR photographs did the trick and I was selected. I actually installed my finished images at the Baker Tilly offices lastweek, and they seem very happy with them. I elected to install 3 images (see below).

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Share:

Baker Tilly Competition

EASA HQ

I entered and was shortlisted (but didn’t win) this competition to design a paint job for the iconic ‘Moonfish’ building. It’s being rebranded / launched as the HQ for the European Architecture Students Assembly 2010 (which is in Manchester). The winner was announced last Friday, and was Nicos Yaitros from Cyprus; a well deserved winner with a great design. My entry proposed using perspective and illusions to try and make the building disappear, see below (click for a larger version). 

Share:

EASA HQ (Moonfish) Competition

Digg
  • Clement Freud, dead. Pretty sad, I guess he seemed to have a good life. Thanks for all the minutes. #
  • Nice to know not alone; http://tinyurl.com/cm7a4u #
  • @rizom interesting you used the same words as me “web as canvas” – just posted an old essay with that title @ joesart.org #
Share:

Twitter Updates for 2009-04-19

Digg

This is an essay that I wrote last year for University. Though I don’t think it’s bad - it could certainly be improved. It should still be of some use / relevance. I really found writing it made me get my head round the concepts I was writing about, and although I understood them all already, it really brought them into focus. Anyway, it’s here; Web as Canvas.

Share:

Web as canvas: The evolution of the world wide web as a creative forum

Digg
  • @casualeveryday ever fix your computer playing music randomly? Mine is doing it! Was it some weird female vocal thing? #
  • @casualeveryday thanks for heads up. I really thought I’d gone mad when it started, had no idea where it was coming from. cheers again. in reply to casualeveryday #
  • @Kate_Butler http://tinyurl.com/cafbot – don’t worry, my laptop is playing music on its own! #
  • think i have hay fever, twitter seems to confirm others do too… so maybe i do. Suppose that is preferred to a full on cold #
Share:

Twitter Updates for 2009-04-12

SEO Powered by Platinum SEO from Techblissonline