Category Archives: Concepts

Baker’s Yeast Sonification

Posted on by
1

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Data Sonification

Posted on by
Reply

I’ve been thinking about Sonification (has a definition on Wikipedia, even if it isn’t a real word) of data for sometime. My first experiment used this blog. A hidden iFrame on the main page opened a page on a web server running off my laptop. These requests were then converted to audio and played out of the laptop’s speaker. I’m interested in the concept of listening to data all together, and in particular web / internet data is especially intriguing. Similarly I’ve recently become inspired by autonomous art works, things that do their own thing without intervention, and even better than that they do something entirely unpredictable.

My research has progressed, and now rather than using a simple PC speaker my software outputs MIDI information. That can then be interpreted by all means of other software, or even hardware synthesisers to actually turn the data into sound. Also I’ve stopped using this blog as the data source, I’ve actually obtained a months worth of web server log data. This has given me about 7 million records to use as my data set. Due to the way the software processes data the amount of time that it would take to “play” is equal to the amount of time that data took to collect. So, the months worth of data I’m using currently would actually take 1 month to listen to. Here’s a few excerpts from my current set up.

Example 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 2

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 3

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 4

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

The “rules” that the software adheres to are as follows.

  • MIDI note is determined by an addition of each segment of the clients IP address, which is then divided by 8. The reasoning behind this is that there are 128 possible MIDI notes. The sum of IP address segments has 1024 different possibilities. 1024 / 8 is 128; so this calculation will always provide a valid MIDI note.
  • Length of note is determined by looking at the length of time in between web requests. This means in busy periods the software produces lots and lots of notes, whereas at quiet times (in the middle of the night) very few notes are played.

In time I’d like to further develop the system, exploring using other things as parameters with which to modulate aspects of the synthesis. One idea is to look at the geographical location of the client and then alter the sound accordingly in some way. This could work very well with a multiple speaker set up. Also plugging the system into the live log data would be really exciting.

A further development would introduce a visual element to the software. Illuminating variou screen sections according to IP address processing, like the audio. I haven’t looked into that as yet though..! It would probably mean transferring the MIDI processing code from VB into Processing; no bad thing me thinks.

Baker Tilly Comp

Posted on by
2

I’m going to pitch some HDR photographs to Chartered Accountants Baker Tilly. The concept is to show Manchester financial architecture, new and old, in stunning HDR.

I visited the site of Baker Tilly’s offices last week to get a feel for the place, it’s around Hardman Square in Manchester. I only managed to take 2 shots before being moved along by a security guard. It was still useful to get some test shots and have a look at the site. These aren’t actually HDR, but are “pseudo-HDR” generated from single RAW files.

BtAnim: Processing Animator + Bluetooth V1

Posted on by
Reply

I’ve spent a couple of days this week working with Processing – a programming environment designed for artists and designers. I’ve found it surprisingly fun. It happens very rarely with software, that you just identify with it straight away. It happened with me and Ableton Live, and that has culminated in my album.

Anyway. I’ve managed to create something – currently extremely unimaginatively titled BtAnim. As with a lot of my work it is really just a framework for something else to happen. How it works is this;

To begin with BtAnim just displays the starting image on the screen. Anyone who sees it can add their own frame to the animation, by taking a photo on their mobile phone and bluetoothing it to the computer. If you watch the video example here, you will see that as time goes on, more frames are added (although the video is just from my own testing) just as they will be when people are contributing their own images.  That’s it.

I thought it would work really well in a public place like a shop window or something.

Technically it is my usual mish-mash of hacking together some code in Processing, using BlueSoleil for the bluetooth component and PHP to monitor incoming files. Watch this space.

Keeping Busy

Posted on by
Reply

I need to keep busy over the Christmas break from University. Although the year is normally split into 3 segments, this year (the final one) is basically split in half. And I’m at the halfway point. So I need to keep up with making things, writing things and formulating what I’m going to do at the end of the year. Here’s a few things that I want to get on with.

Continue reading →

Distributed Video Feedback

Posted on by
Reply

Feedback is an immensely interesting subject with many philosophical facets and a massive array of applications.

I’d like to set up a feedback loop that is distributed among remote locations. For it to work I’ll need to have two computers, each equipped with a camera and an internet connection. The screen on computer 1, will show the live video feed (streamed through the net) from computer 2. The screen on computer 2, will show the live video from computer 1. The cameras attached to both computers would point at the screens.

Adding some kind of moving subject infront of either camera would possibly produce more interesting results.

It would be ideal to increase the number of computers in the chain. The more distributed (and global) the better. Degredation of quality, however, would probably ruin the image after a few iterations – though maybe it would actually create something really good.

Web Server Art

Posted on by
1

If you run a website, or put a web server online, it shouldn’t take long before you start getting hits. Most of the hits are from automated bots, but still you get them. Following on from my previous post, I thought it might be interesting to have a custom web server that produced sound directly from the HTTP requests that it got; whilst still delivering the HTML content to the requestor.

Hmmm.

- Update, I’ve just hacked together a webserver that will make my laptop beep everytime there is a hit on it. So- if you’re reading this then make my PC beep by clicking here.

Sound As Data & Data As Sound

Posted on by
Reply

I’m going to explore the audification of data. It would be fantastic if I can get ‘inside’ a data set by audifying it. Daniel Cummerow’s work with algorithmic music is really fantastic and revealing, and working with mathematics is attractive.  I may take maths as the starting point – its easy to transform maths into sound, they go hand in hand – but ultimately it would be nice to have some kind of more Universal generator that can take in any database and with minimal interference produce a sound work.

One possible approach would be to use web activity as the data source.

How about a website that produces a tone. The frequency of the tone could be denoted by the number of visitors – or some other factor that is effected by the visitation. Java.. Get Sam to help!

Textual Twitter T’ing

Posted on by
Reply

I’ve just returned from a trip to London, with mixed fortunes. I didn’t do quite what I wanted, but I’ve come back inspired. Its culminated with my mind being full of art stuff that I want to do – at some point. Twitter is going to be my starting point, as a dataset to work with. Anyhow. This is the story.

I failed to go to a party at Lo Recordings, which Leo invited me to, which was annoying. As it happened I made it to Old Street, and was waiting for a bus there, when my mobile phone died. It took with it the address I was going to, the contact numbers of the people there and any chance of finding the place. So I took the tube back to Fulham where I was staying. Effectively making a 2 hour round trip to nowhere. Making matters worse the travelling between Fulham (West) and Central & East made it impossible for me to go and see the first ever Starting Teeth gig – which was another annoyance.

On the plus side, I briefly met both members of Starting Teeth and Nathan Fake in some bar on Brick Lane. And indeed, it was the first time I’d ever been to Brick Lane so that was cool too….

Continue reading →

Hypercondria Movie

Posted on by
Reply

While “researching” my Hollyoaks concept I came across a similar idea, but simply supplementing Hollyoaks for Hypercondria.

Again, like the soap operas, I suffer from this terribly. Horrendously in fact. And so do many of my peers. I think it will work well!

I think the Hypercondria, Hollyoaks and Commuters are all good ideas. Maybe the three could become one longer film?