Version 1 Version 2  (feat. Jiggerypokery by Fred)

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

My research has progressed, and now rather than using a simple PC speaker my software outputs MIDI information. That can then be interpreted by all means of other software, or even hardware synthesisers to actually turn the data into sound. Also I’ve stopped using this blog as the data source, I’ve actually obtained a months worth of web server log data. This has given me about 7 million records to use as my data set. Due to the way the software processes data the amount of time that it would take to “play” is equal to the amount of time that data took to collect. So, the months worth of data I’m using currently would actually take 1 month to listen to. Here’s a few excerpts from my current set up.

Example 1 Example 2 Example 3 Example 4

The “rules” that the software adheres to are as follows.

• MIDI note is determined by an addition of each segment of the clients IP address, which is then divided by 8. The reasoning behind this is that there are 128 possible MIDI notes. The sum of IP address segments has 1024 different possibilities. 1024 / 8 is 128; so this calculation will always provide a valid MIDI note.
• Length of note is determined by looking at the length of time in between web requests. This means in busy periods the software produces lots and lots of notes, whereas at quiet times (in the middle of the night) very few notes are played.

In time I’d like to further develop the system, exploring using other things as parameters with which to modulate aspects of the synthesis. One idea is to look at the geographical location of the client and then alter the sound accordingly in some way. This could work very well with a multiple speaker set up. Also plugging the system into the live log data would be really exciting.

A further development would introduce a visual element to the software. Illuminating variou screen sections according to IP address processing, like the audio. I haven’t looked into that as yet though..! It would probably mean transferring the MIDI processing code from VB into Processing; no bad thing me thinks.

I visited the site of Baker Tilly’s offices last week to get a feel for the place, it’s around Hardman Square in Manchester. I only managed to take 2 shots before being moved along by a security guard. It was still useful to get some test shots and have a look at the site. These aren’t actually HDR, but are “pseudo-HDR” generated from single RAW files.

[View with PicLens]

Anyway. I’ve managed to create something – currently extremely unimaginatively titled BtAnim. As with a lot of my work it is really just a framework for something else to happen. How it works is this;

To begin with BtAnim just displays the starting image on the screen. Anyone who sees it can add their own frame to the animation, by taking a photo on their mobile phone and bluetoothing it to the computer. If you watch the video example here, you will see that as time goes on, more frames are added (although the video is just from my own testing) just as they will be when people are contributing their own images.  That’s it.

I thought it would work really well in a public place like a shop window or something.

Technically it is my usual mish-mash of hacking together some code in Processing, using BlueSoleil for the bluetooth component and PHP to monitor incoming files. Watch this space.

Depressing Starbucks

I just got back from a trip to the city centre, I wanted to do some shopping, however I got the fear after about an hour of browsing and decided to abandon the mission and come home. It was quite good though, for the first time in ages I actually had my MP3 player with me, as well as headphones. Normally I don’t have the latter; a constant frustration. Meandering around, listening to good music, catching the occasional smile from a stranger. I really enjoyed it actually.

Just as I passed one of the many Starbucks in Manchester I was reminded of an idea I had when me and my sister were on a demonstration supporting Karen Reissmann.

During the demo we must have passed about 5 branches of Starbucks. Each one was populated with a row of people in the window seats. Their faces were long. Like horses. Their eyes full of sorrow. They weren’t brought to life by the caffein hit they were indulging gifting themselves. It was really extraordinary. It didn’t matter how man Starbucks branches we passed, these window dwellers mood never seemed to improve. For some reason those with a blue mood seem to congretate around in the stools by the windows. Those in the interior were not as woefully depressed-looking. I want to do a series of photographs based on this. A good excuse to use my zoom lens.

The Stile Appreciation Society

After becoming aware of some inspirational societies (Clouds, Pylons), and having an excellent brainstorm with Jody in the Music Box, I’ve decided to found the Stile Appreciation Society.

Over the Christmas period I’m going to seek out some of the stiles hiding around Keighley and maybe I’ll go up into the Dales to find some real beauties.

Photobombing

Photobombing was a great idea when I first had it, in the summer of 2007. I knew that it was good, and I really liked it, so I dived in head first. At that point I said that Photobombing was the utterly pointless act of attaching photographs to public places for random strangers to find. And I did it, I put hundreds of photos all over the place for people to find, each one was tagged with a label on the back uniquely identifying that image and asking whoever finds it to visit Photobombing.com and leave their comment and a new image that incorporates the old one. It worked pretty well, however I’d set up a very inefficient system. All the photos were stored on Flickr and the website was a Blogger blog – which allowed for very limited customisation.

Since then I’ve tried several times to rekindle my interest for Photobombing, but I’ve always run into some technical issue with the website that’s put me off. I think I need to return to my ‘gung-ho’ attitude that I had in the first place.

One key change that I’ve identified is to distribute the photos among people that I actually know, rather that relying on a random person from the off. Relying on people picking up the images from the street at random although romantic, in reality, means that the ratio of images to images with responses is really small.

I’d like to set up a feedback loop that is distributed among remote locations. For it to work I’ll need to have two computers, each equipped with a camera and an internet connection. The screen on computer 1, will show the live video feed (streamed through the net) from computer 2. The screen on computer 2, will show the live video from computer 1. The cameras attached to both computers would point at the screens.

Adding some kind of moving subject infront of either camera would possibly produce more interesting results.

It would be ideal to increase the number of computers in the chain. The more distributed (and global) the better. Degredation of quality, however, would probably ruin the image after a few iterations – though maybe it would actually create something really good.

Hmmm.

- Update, I’ve just hacked together a webserver that will make my laptop beep everytime there is a hit on it. So- if you’re reading this then make my PC beep by clicking here.

One possible approach would be to use web activity as the data source.

How about a website that produces a tone. The frequency of the tone could be denoted by the number of visitors – or some other factor that is effected by the visitation. Java.. Get Sam to help!

I failed to go to a party at Lo Recordings, which Leo invited me to, which was annoying. As it happened I made it to Old Street, and was waiting for a bus there, when my mobile phone died. It took with it the address I was going to, the contact numbers of the people there and any chance of finding the place. So I took the tube back to Fulham where I was staying. Effectively making a 2 hour round trip to nowhere. Making matters worse the travelling between Fulham (West) and Central & East made it impossible for me to go and see the first ever Starting Teeth gig – which was another annoyance.

On the plus side, I briefly met both members of Starting Teeth and Nathan Fake in some bar on Brick Lane. And indeed, it was the first time I’d ever been to Brick Lane so that was cool too….

Back to the point – when I was in London I also went to the Tate Modern and had a good look round. It was really good. I’m normally not the most attentive person, when looking round an art gallery, I have a relatively low boredom threshold – whether the art is good or bad – but here I was interested for the whole 2 hours or so I spent there.

However the best part was the bookshop. Now I’m not a big reader at all. In fact in the last 5 years I’ve probably read about 3 books. I used to read more, commuting almost makes reading a must. Due to having recently finished my University dissertation (or ‘extended essay’) I’ve had my head in a few books and a lot of websites, and have kind of got the bug a little bit again. So I found this book “Database Aesthetics: Art in the Age of Information Overflow” (Victoria Vesna) – which I’m still reading – but I came across an interesting piece by Nancy Paterson, the stock market skirt (live webcam animation shown below).

In really simple terms, it works by tracking the stock market. The higher the market goes, the higher and tighter the hem line of the skirt gets. I think what began with Net artists in the 90s has brought about a boom in networked installations, like Paterson’s skirt. I guess the boom in networking and computing in general probably goes hand in hand with that though.

I’m interested in using Twitter – a kind of micro-blogging website – as the data source for a similar piece. The idea of using real world data, especially things that are easily accessible, and creating something more physically tangible out of it is a really interesting concept and a good area for artistic exploration.

Again, like the soap operas, I suffer from this terribly. Horrendously in fact. And so do many of my peers. I think it will work well!

I think the Hypercondria, Hollyoaks and Commuters are all good ideas. Maybe the three could become one longer film?