So. The other reason for this post is to explain the website, and provide links for people.

For Joe Galen the musician, Creaked Records, my music site, and Myspace.

For Joe Galen the artist, you’re in the right place, but unfortunately the place isn’t right! This website was originally my journal, and has slowly evolved into what it is today – a mess. Here’s some links to my favourite bits though: HDR photographs, baker’s yeast sonification, some videos.

If you want to email me… please use this form!

Version 1 Version 2  (feat. Jiggerypokery by Fred)

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

[View with PicLens]

 

My work  is sharing a room with Rachel Louise Evans’ work (below) – her work is constructed from 18,000 paper clips..!

Daniel Cummerow has made various MIDI files (musical arrangements) that are generated by tapping into various areas of mathmatics. He’s producing the sound of maths. A fantastic idea. It also explains – to some extent – the multi-timbral soundscapes that Max Tundra produces.

Listen to an example of Daniel’s work, using Pascal’s Triangle. This is a MIDI file, most media players should be able to play it OK. Read about MIDI here.

I figured this was a cool example of how data meets art meets data.

I took this strange composition just after new year, at my parents house. Always wash your fruit!

Anyway; here’s the response.

Dear Mr Lindley

Re: Your complaint about NiQuitin advertising

Thank you for your recent complaint about a TV ad for this product.

I understand you object to the term ‘therapeutic nicotine’ because Wikipedia says therapeutic means the attempted remediation of a health problem, which you feel does not apply.  We have reviewed the ad but on this occasion, we will not be taking further action.

When assessing complaints about TV ads, we have to consider how viewers are likely to interpret the claims.  In this case we think that viewers are likely to understand that nicotine is highly addictive and is the element within cigarettes that makes giving up smoking very difficult.   While your definition of therapeutic may be correct, we note that it also has the meaning of being “soothing” or “conducive to well-being”.

We have reviewed the ad and note it does not claim to cure nicotine addiction but rather by providing a controlled supply of nicotine, the product is able to calm the symptoms of withdrawal and so allow the person to concentrate on something other than their craving for cigarette.  On this basis, because we think that people are likely to understand that the claims are made in the context of an ad for an anti-smoking product, we don’t think that this ad is likely to harm consumers or mislead them to their detriment.

I am sorry that we are unable to investigate your complaint further, but thank you for taking the time to contact us.

Yours sincerely,

Karen Harms

Complaints Executive

My research has progressed, and now rather than using a simple PC speaker my software outputs MIDI information. That can then be interpreted by all means of other software, or even hardware synthesisers to actually turn the data into sound. Also I’ve stopped using this blog as the data source, I’ve actually obtained a months worth of web server log data. This has given me about 7 million records to use as my data set. Due to the way the software processes data the amount of time that it would take to “play” is equal to the amount of time that data took to collect. So, the months worth of data I’m using currently would actually take 1 month to listen to. Here’s a few excerpts from my current set up.

Example 1 Example 2 Example 3 Example 4

The “rules” that the software adheres to are as follows.

• MIDI note is determined by an addition of each segment of the clients IP address, which is then divided by 8. The reasoning behind this is that there are 128 possible MIDI notes. The sum of IP address segments has 1024 different possibilities. 1024 / 8 is 128; so this calculation will always provide a valid MIDI note.
• Length of note is determined by looking at the length of time in between web requests. This means in busy periods the software produces lots and lots of notes, whereas at quiet times (in the middle of the night) very few notes are played.

In time I’d like to further develop the system, exploring using other things as parameters with which to modulate aspects of the synthesis. One idea is to look at the geographical location of the client and then alter the sound accordingly in some way. This could work very well with a multiple speaker set up. Also plugging the system into the live log data would be really exciting.

A further development would introduce a visual element to the software. Illuminating variou screen sections according to IP address processing, like the audio. I haven’t looked into that as yet though..! It would probably mean transferring the MIDI processing code from VB into Processing; no bad thing me thinks.